Loading
Home › Biology Help › Due in 3 hours only three questions
Status: Completed
 View Work

Due in 3 hours only three questions

Date Posted: 09/02/2018
Category: Biology
Due Date: 10/02/2018
Instruction
Biolgey
Attached
Download File 1 (jpeg)
Download File 2 (png)
Tutor Uploads
Download File 1 (docx)
Download File 2 (docx)
Bidders
komatsu 8 years, 7 months ago
Rated 8.8 earned 25673.74 around 681 assignments.
Hello
$20.00
  • I have seen the instructions. Kindly assign me this task
    komatsu | Feb 09, 2018, 17:53 PM
  • Did you actually read the questions ? All of them are how many !! And u wanna cost me 45 dollars that’s kinda too much
    User_13435 | Feb 09, 2018, 17:55 PM
  • They are only 3. But the urgency in which you need them done can only amount on higher pay.
    komatsu | Feb 09, 2018, 17:58 PM
  • Well I can’t pay that much honestly
    User_13435 | Feb 09, 2018, 17:59 PM
  • Three hours is such a short time. If you are interested, we can do it at $30
    komatsu | Feb 09, 2018, 17:59 PM
  • Well I can do I’m just at work that’s why I want someone else to do it.
    User_13435 | Feb 09, 2018, 18:02 PM
  • Else, extend that deadline to 6 hours
    komatsu | Feb 09, 2018, 18:02 PM
  • It’s due exactly in 3 hours and I’m working so will you be able to do it for 20 ?
    User_13435 | Feb 09, 2018, 18:04 PM
  • Please raise that price a bit and I will do your task. I am a trained biochemist and have done Molecular biology
    komatsu | Feb 09, 2018, 18:06 PM
  • I can’t in student I don’t have that much
    User_13435 | Feb 09, 2018, 18:07 PM
  • I have changed the bid to $20
    komatsu | Feb 09, 2018, 18:07 PM
  • Please I trust you and I’ll assign you over all ppl texted me
    User_13435 | Feb 09, 2018, 18:08 PM
  • Okay. I will not disappoint you
    komatsu | Feb 09, 2018, 18:09 PM
  • And do it in ur own words and I don’t want to get caught with blgrasim
    User_13435 | Feb 09, 2018, 18:11 PM
  • I don't plagiarize my work.
    komatsu | Feb 09, 2018, 18:13 PM
  • You can now assign
    komatsu | Feb 09, 2018, 18:15 PM
  • Done
    User_13435 | Feb 09, 2018, 18:18 PM
  • Thank you!
    komatsu | Feb 09, 2018, 18:18 PM
  • Use the link that attached above the questions please
    User_13435 | Feb 09, 2018, 18:20 PM
  • Okay
    komatsu | Feb 09, 2018, 18:39 PM
  • Do I have all the information?
    komatsu | Feb 09, 2018, 19:41 PM
  • What u mean ?
    User_13435 | Feb 09, 2018, 19:42 PM
  • Is there something I am missing all you sent everything? I presume there was a gene of choice
    komatsu | Feb 09, 2018, 19:42 PM
  • I’ll send everything now
    User_13435 | Feb 09, 2018, 19:43 PM
  • I attached the whole paper
    User_13435 | Feb 09, 2018, 19:45 PM
  • Please send. You just sent a screenshot of the question without the any nucleotide to analyse using web cutter
    komatsu | Feb 09, 2018, 19:45 PM
  • I did send it
    User_13435 | Feb 09, 2018, 19:45 PM
  • I have seen it
    komatsu | Feb 09, 2018, 19:47 PM
  • Got it ?
    User_13435 | Feb 09, 2018, 19:47 PM
  • Please send me a word document. It is not possible to type that long DNA or rna nucleotide
    komatsu | Feb 09, 2018, 19:48 PM
  • I don’t know how to send it. I just attached what the professor wants
    User_13435 | Feb 09, 2018, 19:49 PM
  • Or perhaps you send a pdf. But it is impossible to use an Image . I need to copy and paste that DNA sequence in the software
    komatsu | Feb 09, 2018, 19:51 PM
  • ttggaacaaccaataggagtcattgattccggggttggcggtttaaccgttgcgaaggaaatcatgagacagctacctaaagaaaatattatctacgtcggggatacgaaacggtgtccttatggtccgcgccctgaagaagaggtgcttcaatatacgtgggagctgacgaattatttactcgaaaaccaccacatcaaaatgctcgtgatcgcctgtaatacagcaacagcgatcgctttggatgacatccagcgcagcgtcggcataccggtggtcggagtcatccagcctggtgcgagagcagcgataaaagtgacggataatcagcatatcggtgtcatcggcacagagaatacgattaagagcaatgcatacgaagaagcgcttttggcattaaaccctgatttgaaggttgaaaaccttgcctgcccgctgcttgtgccttttgtggaaagcgggaagtttctcgacaaaacagcagacgagattgttaaaacctcgctgtatccgttaaaagacacatcaattgattcgctgattttaggctgcacccattaccctattttaaaagaagccattcaaagatatatgggagagcacgtaaacattatttcgtccggcgatgaaacagcccgggaagtcagcacaattctctcttataaagggctgctgaaccagtctccgattgccccggatcatcagttcctgacaacaggggcgcgtgatcagtttgcaaaaatcgcagacgattggtttggccatgaagtcgggcatgtggaatgtatctcactgcaagaaccgattaaaagatag
    User_13435 | Feb 09, 2018, 19:52 PM
  • Try and copy paste that long sequence and send it here as a message
    komatsu | Feb 09, 2018, 19:52 PM
  • Thank you!
    komatsu | Feb 09, 2018, 19:53 PM
  • I just did
    User_13435 | Feb 09, 2018, 19:53 PM
  • Hope its the full sequence
    komatsu | Feb 09, 2018, 19:53 PM
  • Idk I copy it and baste it. Worst case just answer the questions
    User_13435 | Feb 09, 2018, 19:54 PM
  • I have finished the assignment
    komatsu | Feb 09, 2018, 20:24 PM
  • The first file I will upload is the answer for the three questions
    komatsu | Feb 09, 2018, 20:24 PM
  • The second file I will upload is the evidence(in case your professor asks) whether you actually did the assignment. I have attached the screenshots results of the analysis.
    komatsu | Feb 09, 2018, 20:26 PM
  • She only wants how many without saying what they are
    User_13435 | Feb 09, 2018, 20:37 PM
  • Okay. In that case you will just need to just submit the first file
    komatsu | Feb 09, 2018, 20:39 PM
  • Please remember to release the funds. And please give me a nice feedback/ratings. I have really pulled this up with a very short deadline. I can guarantee you you are getting A++.
    komatsu | Feb 09, 2018, 20:58 PM
  • I have also done some basic Bioinformatics. So, in case you have another task, do not hesitate getting back to me
    komatsu | Feb 09, 2018, 20:59 PM
  • Why have you not release the funds yet?
    komatsu | Feb 10, 2018, 04:06 AM
  • Oh sry I thought I did I’ll now
    User_13435 | Feb 10, 2018, 04:29 AM
  • Done
    User_13435 | Feb 10, 2018, 04:30 AM
  • Please give me a 10 star rating. I responded so quickly
    komatsu | Feb 10, 2018, 04:34 AM
  • Thanks for releasing the funds
    komatsu | Feb 10, 2018, 04:35 AM
  • You have not given me a feedback yet
    komatsu | Feb 10, 2018, 16:04 PM
  • Hey. Please rate me
    komatsu | Feb 14, 2018, 05:02 AM
  • Thanks so much for the ratings.
    komatsu | Feb 14, 2018, 15:30 PM
  • Hey. Are you able to do other really short biology homework?
    User_13435 | Feb 16, 2018, 01:47 AM
  • Hey Yes. Please assign me
    komatsu | Feb 16, 2018, 02:50 AM
  • I can only pay 15 dollars this tho and it’s 4 question about article I’ll attche too
    User_13435 | Feb 16, 2018, 02:51 AM
  • No problem. I am ready to do it. Have you posted it already?
    komatsu | Feb 16, 2018, 02:56 AM
  • No. Should I post it and then u text me ?
    User_13435 | Feb 16, 2018, 02:58 AM
  • ???
    User_13435 | Feb 16, 2018, 03:02 AM
  • Exactly. Just posy it. I will text you.
    komatsu | Feb 16, 2018, 03:03 AM
  • Done
    User_13435 | Feb 16, 2018, 03:06 AM
  • Please assign me. I have texted you.
    komatsu | Feb 16, 2018, 03:12 AM
  • {$ item.message_content $}
    {$ item.sender_username $} | {$ item.date_entered $}

{$ chatErrMsg[0] $}

{$ showNewChatSuccessMsg[0] $}
Unable to send Message: {$ showChatProcessErrorMsg[0] $}
 
 
TheBest 8 years, 7 months ago
Rated 9.56 earned 22900.84 around 598 assignments.
Hello dear client; kindly award me this project. I have extensive and wide knowledge in academic writing. My clients are my priority; I ensure high notch piece of work.
$40.00
  • {$ item.message_content $}
    {$ item.sender_username $} | {$ item.date_entered $}

{$ chatErrMsg[1] $}

{$ showNewChatSuccessMsg[1] $}
Unable to send Message: {$ showChatProcessErrorMsg[1] $}
 
 
WBURO 8 years, 7 months ago
Rated 9.25 earned 75605.06 around 2167 assignments.
How are you there?..For your assignment above I assure to provide quality work that is free from plagiarism and in time, kindly consider my bid
$40.00
  • {$ item.message_content $}
    {$ item.sender_username $} | {$ item.date_entered $}

{$ chatErrMsg[2] $}

{$ showNewChatSuccessMsg[2] $}
Unable to send Message: {$ showChatProcessErrorMsg[2] $}